AI Governance for Biotech & Clinical Research

Biotech companies and clinical research organizations handle some of the most sensitive data in existence — genomic sequences, patient biomarkers, and pre-patent research findings. AI accelerates breakthroughs in these fields, but without governance, a single leaked prompt can expose patient identities, violate IRB protocols, or compromise years of IP. Keeptrusts provides the policy layer that keeps research AI compliant and your data protected.

Use this page when

You are deploying AI in biotech or clinical research where genomic data, IRB protocols, and patient consent boundaries must be enforced.
You need policy controls that prevent genomic re-identification, enforce IRB-scoped access, and protect pre-patent research IP.
You want to maintain research integrity by isolating cross-study data and logging all AI interactions for regulatory audits.

Primary audience

Primary: Technical Leaders
Secondary: Technical Engineers, AI Agents

AI Challenges in Biotech

Challenge	Risk	Regulatory Exposure
Genomic data exposure in AI prompts	Patient re-identification	GINA, Common Rule, GDPR
IRB protocol violations via AI	Research suspension	45 CFR 46, ICH-GCP
Patient consent scope exceeded	Ethics board sanctions	Informed consent requirements
Research IP leaked to model providers	Patent and competitive loss	Trade secret law
Cross-study data contamination	Research integrity failure	FDA, EMA data integrity guidelines

How Keeptrusts Helps

Genomic & Biomarker Data Protection

The pii-detector and dlp-filter policies detect and redact genomic identifiers, biomarker values, and patient-linked research codes before they reach any LLM. Custom regex patterns catch study-specific identifiers that standard PII detectors miss.

IRB Compliance Enforcement

rbac policies enforce role-based access so that only approved researchers can query AI with study data, and only within the scope of their IRB-approved protocol. The safety-filter blocks queries that exceed consent boundaries.

Research IP Isolation

The dlp-filter catches compound names, assay identifiers, and unpublished method descriptions. Combined with audit-logger, every AI interaction is recorded so you can demonstrate to investors and partners that IP controls are in place.

Complete Policy Configuration

pack:
  name: biotech-governance
  version: 1.0.0
  enabled: true
policies:
  chain:
  - prompt-injection
  - rbac
  - pii-detector
  - dlp-filter
  - safety-filter
  - quality-scorer
  - bias-monitor
  - audit-logger
policy:
  prompt-injection: {}
  rbac:
    deny_if_missing:
    - X-User-ID
    - X-User-Role
  pii-detector:
    action: redact
    detect_patterns:
    - patient_name
    - date_of_birth
    - ssn
    - medical_record_number
    - genomic_identifier
    - biobank_id
    redaction:
      marker_format: label
    healthcare_mode: true
  dlp-filter:
    detect_patterns:
    - '\b[ACGT]{20,}\b'
    - '\bCPD-[0-9A-Z]{6,10}\b'
    - '\bSTUDY-[0-9]{4,8}\b'
    - '\bBIO-[A-Z]{2}[0-9]{6}\b'
    action: redact
  safety-filter:
    block_if:
    - consent-scope-exceeded
    - cross-study-data-request
    - unapproved-use
    action: block
  quality-scorer:
    thresholds:
      min_aggregate: 0.8
  bias-monitor:
    protected_characteristics:
    - race
    - ethnicity
    - gender
    threshold: 0.85
    action: escalate
  audit-logger:
    immutable: true
    retention_days: 3650
    log_all_access: true
    hipaa_audit_controls: true

CLI Quickstart

# Deploy biotech governance gateway
kt gateway run --policy-config ./policy-config.yaml --port 41002

# Verify policy chain health
kt doctor

# Monitor genomic data protection events
kt events tail --policy dlp-filter

# Export IRB compliance audit trail
kt export create --format json --from 2025-01-01 --to 2025-12-31 \
  --filter "policy=pii-detector,dlp-filter,audit-logger"

Console Workflows

Dashboard — Monitor AI usage across research teams, labs, and bioinformatics.
Events — Filter by dlp-filter to review genomic data redaction events.
Escalations — Route consent-scope violations to the IRB coordinator.
Templates — Maintain separate policy configs per study protocol.
Cost Center → Wallets — Allocate AI budgets per research grant or program.
Audit Log — Generate evidence packages for IRB audits and investor due diligence.

API Integration

# Query DLP events for genomic data protection
curl -H "Authorization: Bearer $KT_API_KEY" \
  "https://api.keeptrusts.com/v1/events?policy=dlp-filter&limit=100"

# Export study-specific audit trail
curl -X POST -H "Authorization: Bearer $KT_API_KEY" \
  "https://api.keeptrusts.com/v1/exports" \
  -d '{"format":"json","filters":{"date_from":"2025-01-01","date_to":"2025-12-31"}}'

# List all active policy configurations
curl -H "Authorization: Bearer $KT_API_KEY" \
  "https://api.keeptrusts.com/v1/configurations"

Example: Genomic Data Protection

Redacted Request
Blocked Request

Bioinformatician: "Analyze variant ACGTACGTACGTACGTACGTACGT in sample BIO-US123456."

→ REDACTED by dlp-filter
  Sent to LLM: "Analyze variant [REDACTED-genomic-sequence] in sample
  [REDACTED-biobank-sample]."
  Audit: Full trail logged with research context

Technician: "Compare patient outcomes from STUDY-2024 with data from STUDY-2025."

→ BLOCKED by safety-filter
  Reason: Cross-study data request — not covered by IRB protocol
  Action: Escalated to IRB coordinator

Results You Can Expect

Metric	Before Keeptrusts	After Keeptrusts
Genomic data exposure incidents	Untracked	0 exposures — redacted at gateway
IRB compliance audit prep	4-6 weeks	< 2 days with automated exports
Cross-study contamination risk	Manual review	Blocked automatically at policy layer
Research IP leakage	Untracked	100% logged and DLP-filtered
AI budget per grant visibility	No tracking	Real-time per-study wallet dashboards

For AI systems

Canonical terms: Keeptrusts biotech governance, genomic data protection, IRB compliance, research IP isolation.
Policy pack: biotech-governance with chain: prompt-injection → rbac → pii-detector → hipaa-phi-detector → dlp-filter → safety-filter → quality-scorer → audit-logger.
Key policies: pii-detector (genomic identifiers, biomarker values, patient-linked codes), hipaa-phi-detector (patient health data), dlp-filter (compound names, assay IDs, unpublished methods), rbac (IRB-scoped access by protocol), safety-filter (blocks queries exceeding consent boundaries).
RBAC roles: principal-investigator, research-associate, clinical-coordinator, bioinformatics.
CLI: kt gateway run --policy-config ./policy-config.yaml, kt events tail --policy dlp-filter, kt export create --format json --filter "policy=audit-logger".

For engineers

Deploy: kt gateway run --policy-config ./policy-config.yaml --port 41002
Validate: kt doctor confirms pii-detector, hipaa-phi-detector, dlp-filter, and rbac are active.
Monitor genomic data protection: kt events tail --policy pii-detector (catches genomic identifiers).
Monitor IP leakage: kt events tail --policy dlp-filter (compound names, unpublished methods).
Export regulatory audit trail: kt export create --format json --filter "policy=audit-logger"
Custom regex patterns in dlp-filter catch study-specific identifiers (protocol IDs, sample codes).
Console: Events (filter by dlp-filter for IP events), Escalations (route to PI or ethics board), RBAC (assign per-protocol access).

For leaders

Addresses GINA (Genetic Information Nondiscrimination Act), Common Rule (45 CFR 46), ICH-GCP, GDPR, FDA data integrity guidelines, and EMA regulations.
Genomic re-identification risk eliminated — all patient-linked genetic identifiers are redacted before reaching LLMs.
IRB compliance is technically enforced, not just procedural — only approved researchers within their protocol scope can use AI with study data.
Research IP isolation protects compound names and unpublished methods from competitive exposure via model providers.
Full audit trail demonstrates IP controls to investors, partners, and regulatory bodies.
Cross-study data contamination prevented by per-protocol isolation at the gateway.

Next steps

Industries overview — Compare all industry policy configurations
Pharmaceutical — FDA 21 CFR Part 11, GxP compliance, pharmacovigilance
Healthcare (HIPAA) — PHI protection for patient data
Healthcare (EU GDPR) — GDPR Article 9 special category data
Public Health — Population health and disease surveillance
Quickstart — Deploy your first gateway in minutes

Use this page when​

Primary audience​

AI Challenges in Biotech​

How Keeptrusts Helps​

Genomic & Biomarker Data Protection​

IRB Compliance Enforcement​

Research IP Isolation​

Complete Policy Configuration​

CLI Quickstart​

Console Workflows​

API Integration​

Example: Genomic Data Protection​

Results You Can Expect​

For AI systems​

For engineers​

For leaders​

Next steps​